KEGG   Bacillus subtilis PY79: U712_11810Help
Entry
U712_11810        CDS       T02937                                 

Definition
(GenBank) Hypothetical Protein
Organism
bsp  Bacillus subtilis PY79
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AHA78303
LinkDB All DBs
Position
complement(2335467..2335580)
Genome map
AA seq 37 aa AA seqDB search
MKKKKARKREGFFLDFLFEVGGELFLLLFRCVHKLFI
NT seq 114 nt NT seq  +upstreamnt  +downstreamnt
atgaaaaagaaaaaagcaagaaagcgtgaggggtttttcctggattttcttttcgaagtt
ggtggggagctctttcttttgctgtttagatgtgtacacaaactatttatataa

DBGET integrated database retrieval system