KEGG   Bacillus subtilis QB928: B657_03359Help
Entry
B657_03359        CDS       T02292                                 

Definition
(GenBank) YczL
Organism
bsq  Bacillus subtilis QB928
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AFQ56270
LinkDB All DBs
Position
365862..366047
Genome map
AA seq 61 aa AA seqDB search
MKSGKASIKDLAVGKGKDLRWGKGLNAVGVFTDLEIGRQREMSAKSCSTPLYIRRSIQFK
S
NT seq 186 nt NT seq  +upstreamnt  +downstreamnt
gtgaaaagcggaaaggcatcgattaaggatcttgctgtcggcaaaggcaaggatttgcga
tggggaaaaggattaaacgcggttggagtctttactgatttagaaatcgggcggcagcga
gaaatgagcgcgaaaagctgctctacaccattgtacatacggcgaagtattcaatttaaa
tcgtaa

DBGET integrated database retrieval system