KEGG   Bacillus subtilis subsp. subtilis 168: BSU17670
Entry
BSU17670          CDS       T00010                                 

Gene name
cotU
Definition
(RefSeq) hypothetical protein
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 939580
NCBI-ProteinID: NP_389650
Pasteur: BG13471
BSORF: BG13471
UniProt: O31802
LinkDB
Position
complement(1901117..1901377)
AA seq 86 aa
MGYYKKYKEEYYTWKKTYYKKYYDNDKKHYDCDKYYDHDKKHYDYDKKYDDHDKKYYDDH
DYHYEKKYYDDDDHYYDFVESYKKHH
NT seq 261 nt   +upstreamnt  +downstreamnt
ttgggttattataaaaaatataaagaagagtattatacttggaaaaaaacatattacaaa
aagtattacgacaatgataagaagcattatgattgcgacaagtattatgatcatgataaa
aaacattatgattacgacaaaaagtatgatgaccatgataaaaagtattacgatgatcac
gattatcattacgaaaaaaagtattatgatgacgatgatcattattatgattttgtcgaa
tcatataaaaaacatcactaa

DBGET integrated database retrieval system