KEGG   Bacillus vallismortis: B9C48_02030Help
Entry
B9C48_02030       CDS       T04948                                 

Definition
(GenBank) sporulation protein YjcZ
Organism
bvm  Bacillus vallismortis
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: YjcZ_2
Motif
Other DBs
NCBI-ProteinID: ARM26684
UniProt: A0A1W6HF21
LinkDB All DBs
Position
complement(398282..398377)
Genome map
AA seq 31 aa AA seqDB search
MSGYSGVSSFALIVVLFILLIIVGTAFVGGF
NT seq 96 nt NT seq  +upstreamnt  +downstreamnt
atgtcaggatattcaggagtcagctctttcgctttgatcgttgttttatttatcctgttg
attattgttggtactgccttcgttggcggtttctaa

DBGET integrated database retrieval system