KEGG   Campylobacter coli CVM N29710: G157_07125Help
Entry
G157_07125        CDS       T02838                                 

Definition
(GenBank) type II R-M system restriction endonuclease
Organism
ccc  Campylobacter coli CVM N29710
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AGV10513
LinkDB All DBs
Position
complement(1431270..1431887)
Genome map
AA seq 205 aa AA seqDB search
MFPNILIQIREFLLKNKAQLKQYSRDGRINSAFNEDEITNIIYDNFSINLPNARDWFDFS
FEESGKFYPVNIKITTTRTIDNLNCKLGIYYALTGDIPSFNNGINWDQYFCNLKTNLKEN
SKDYYFLIINKNDVQDIFIASLKSLEKISPNGNNLPFQAKWNENRHPVQREFKEAKDFII
KCFADSLKLRADAYFYFKRYFNEYF
NT seq 618 nt NT seq  +upstreamnt  +downstreamnt
atgtttcctaatatacttattcaaattcgagaatttttattaaaaaataaagctcaatta
aagcaatattcaagagatggaaggataaattctgcttttaatgaagatgagataacaaat
attatatatgataattttagtattaatttgccaaacgctagagattggtttgattttagt
tttgaagaaagtggtaaattttatcctgtaaatataaaaattacaacaacgcgtactata
gataatttaaattgcaaactaggaatatattacgctttaactggtgatattcctagtttt
aataatggaataaattgggatcaatacttttgtaatttaaaaacaaatttgaaagaaaat
tcaaaggattattattttttaattataaataaaaatgatgtccaagatatatttatagcc
tcacttaagagtcttgaaaaaatatcacctaatggcaataatctaccctttcaagcaaaa
tggaatgaaaacagacatcctgtacaaagagaatttaaagaagctaaagattttataata
aaatgttttgctgattctttaaaacttagagctgatgcatatttttattttaaaagatac
tttaatgaatacttttaa

DBGET integrated database retrieval system