KEGG   Caenorhabditis elegans (nematode): CELE_C05G5.6
Entry
CELE_C05G5.6      miRNA     T00019                                 

Gene name
let-7
Definition
(RefSeq) microRNA let-7,b
  KO
K16980  microRNA let-7
Organism
cel  Caenorhabditis elegans (nematode)
Pathway
cel04361  Axon regeneration
Brite
KEGG Orthology (KO) [BR:cel00001]
 09150 Organismal Systems
  09158 Development and regeneration
   04361 Axon regeneration
    CELE_C05G5.6 (let-7)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:cel04147]
    CELE_C05G5.6 (let-7)
  09184 RNA family
   03100 Non-coding RNAs [BR:cel03100]
    CELE_C05G5.6 (let-7)
Exosome [BR:cel04147]
 Exosomal RNA
  Exosomal RNA of breast milk
   CELE_C05G5.6 (let-7)
  Exosomal RNA of saliva
   CELE_C05G5.6 (let-7)
  Exosomal RNA of ovarian cancer cells
   CELE_C05G5.6 (let-7)
  Exosomal RNA of renal carcinoma cells
   CELE_C05G5.6 (let-7)
  Exosomal RNA of other cancer cells
   CELE_C05G5.6 (let-7)
Non-coding RNAs [BR:cel03100]
 Small non-coding RNA
  Micro RNA
   CELE_C05G5.6 (let-7)
SSDB
Other DBs
NCBI-GeneID: 266952
LinkDB
Position
X:complement(14744191..14744212)
NT seq 22 nt   +upstreamnt  +downstreamnt
ctatgcaattttctaccttacc

DBGET integrated database retrieval system