Corynebacterium glutamicum K051: WA5_1160 Help Entry WA5_1160          CDS       T02508                                  Symbol AtpE Name (GenBank) ATP synthase subunit C   KO K02110   F-type H+-transporting ATPase subunit c Organism cgu  Corynebacterium glutamicum K051 Pathway cgu00190   Oxidative phosphorylation cgu01100   Metabolic pathways Module cgu_M00157   F-type ATPase, prokaryotes and chloroplasts Brite KEGG Orthology (KO) [BR:cgu00001]  09100 Metabolism   09102 Energy metabolism    00190 Oxidative phosphorylation     WA5_1160 (AtpE)  09180 Brite Hierarchies   09181 Protein families: metabolism    00194 Photosynthesis proteins [BR:cgu00194]     WA5_1160 (AtpE) Photosynthesis proteins [BR:cgu00194]  Photosystem and electron transport system   F-type ATPase [OT]    WA5_1160 (AtpE) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ATP-synt_C Motif Other DBs NCBI-ProteinID:  CCH24380 LinkDB All DBs Position 1273285..1273527 Genome browser AA seq 80 aa AA seqDB search MNEIILAQDATESTITGLGAVGYGIATIGPGLGIGILVGKALEGMARQPEMAGQLRTTMF LGIAFVEALALIGLVAGFLF NT seq 243 nt NT seq  +upstreamnt  +downstreamnt atgaacgagatcatcctggcacaggacgcaaccgagtccaccatcaccggacttggcgct gtcggctacggcatcgcaaccatcggacctggcctcggcatcggcatcctggttggtaag gctctcgagggtatggcacgtcagcctgagatggctggacagctccgtaccaccatgttc ctgggcatcgccttcgttgaggccctggcactgatcggccttgttgctggcttcctgttc taa

DBGET integrated database retrieval system