KEGG   Drosophila melanogaster (fruit fly): Dmel_CR11538
Entry
Dmel_CR11538      ncRNA     T00030                                 

Gene name
asRNA:CR11538
Definition
(RefSeq) antisense RNA:CR11538
Organism
dme  Drosophila melanogaster (fruit fly)
SSDB
Other DBs
NCBI-GeneID: 26067081
FlyBase: FBgn0017424
LinkDB
Position
3L
NT seq 2386 nt   +upstreamnt  +downstreamnt
atggaagatcttcacgtcgacgaacttgaagttgtggacatcgaagtagtagtcatgctt
caccggcctgttgaaggggaaaccgaagggcagggcgtccacgtagcgggaaccgtgtcc
cacgccgcagctgaccaccggatcgtagccagtgaactgggcaacctcgggctggtggta
cgggtagaccatgtagaagaactggaacacctggccgcccttcttgccgcgcggcagcat
cattcggttgggcacgccgcaatgggcctccgactgatccagcttgaacttgtagtcact
gttggtggcgtccatcagcttctggtagagctccaggtaggtggtgcgatcgttcaccca
gaaggagaagtcaccgctggcgcgcttgatgtggttaacgcccgcctccagatgcacctt
gaagtgctccagctcgaagaagttctggtagttgtgctccagtgggatctcgtgtccgtg
ctcatcgtacttgggtccaatgaagaccttcacaacggcatcctgagccttgtccgaggt
cacgtccagggtgaactcgaagggcttgtggttgagacgctgctggcgggccttgatcac
atagctggatcccttgtagtgggagttcctgccgaaggtgtacaacggatcggcggatcc
ctcaacggcgggctccacattgacggcattgctgatgtccgagtcgaagtgctcgaagta
ggtggtcagactttcgggcatgtggacggcatcgatgtggacaccctcgaaggcgtaatc
cttcttgtggtactccggataggtctccatcagatgccagtagtggctgacaatggtctt
gtatacctcgtagaagatcggatcgcgcatagaggtgtcgtagtgcatgaaaaggccagg
gaagctctcgtcaccatggccataatggtggccctcgttcacaatgaagcggtacagctt
gtcaagactgccgtagaacttcttgtccacgctgtccgcattgccctggatgatgttgcc
cagcacattgatggtctccacatcgaacttctcgttcttgtggatccagtccatgacacg
ctgcgtgtacatctccacatgctcgatgtgctcgtagttgtgctcgtggtagaagctgtg
gtgattctcccggtgccattggggtacgccgtagtaggtgcgcaggttactggcatagcc
ggattcggttggcacatacatgttgaaagcgggcacctcgccgagatcgtgggacagacg
ctccaggtaccaacgggccagcaattgccagtggacatacaggtagagctcaccgcgacg
atccttgttaaggacatgctcctcgccgcccttcgtccagaacggatagtccagattgaa
gtagtagtagaaggcattgaagccaacatcctccaggtagtaggccaaatcgtgatcgta
gttcagggaaccgtgcacgttcgaatagttcgtacggatcaccacgttgtagatgttgtc
catctgcttgacatgatggaagccgtgcattttgtagtgctcagcccattccagtgcctg
gctatcgaagtagctccatgggtggatctcgtagtgggccggcaggacgactccctgcat
atcatcacggaacaaactggcaatggtcacggcgtacacgaacaactgcttgtttacgtg
ctggcgggcccagtagacgacgtgctggaaggtctcccagttcttggcgaagtagaagag
acgcaccagacccaccacatactcctcgtgcttgtcgtacatcaccgaccacaccatgtc
atcggtgaagggttggtgttgccacagctcgaagaagtgctccaacatctccgggtgcac
atagtcggccacgtgctcccacggcttgtactccacgtagctgcccccgaagggcgtggt
gaacacatcgtcctggtagatgtgctgcaggatctggtacatgaacttctgtttcatcag
aaagtccttgtccgccaccttggagtccaggtgcttggcctggccgagagtagccagcaa
tgccactgcagctaacgcaatcaccgtgaacgacttcatcttctcgagtcgattcgaatc
gtaacgctgcaatgatcggtagccagtatttatacccccggatcggcgatacgcagattg
caatccggccaatgaccggtcgcatccgtagccttgatccgcgccatcgccggatctgaa
cgacccgcgaagctctcaatcttagcgcccatgctgcatccataattgcaggtgataaga
ccgacgattaggcggccataccaagatcaatcctacatcattatctaaattcaagagtga
gccactagaaactggtggttaggtgaagcagctggaagatccagtt

DBGET integrated database retrieval system