KEGG   Drosophila melanogaster (fruit fly): Dmel_CR33391
Entry
Dmel_CR33391      rRNA      T00030                                 

Gene name
5SrRNA:CR33391
Definition
(RefSeq) 5S ribosomal RNA
  KO
K01981  large subunit ribosomal RNA, 5S
Organism
dme  Drosophila melanogaster (fruit fly)
Pathway
dme03008  Ribosome biogenesis in eukaryotes
dme03010  Ribosome
Brite
KEGG Orthology (KO) [BR:dme00001]
 09120 Genetic Information Processing
  09122 Translation
   03010 Ribosome
    Dmel_CR33391 (5SrRNA:CR33391)
   03008 Ribosome biogenesis in eukaryotes
    Dmel_CR33391 (5SrRNA:CR33391)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03011 Ribosome [BR:dme03011]
    Dmel_CR33391 (5SrRNA:CR33391)
  09184 RNA family
   03100 Non-coding RNAs [BR:dme03100]
    Dmel_CR33391 (5SrRNA:CR33391)
Ribosome [BR:dme03011]
 Ribosomal RNAs
  Eukaryotes
   Dmel_CR33391 (5SrRNA:CR33391)
Non-coding RNAs [BR:dme03100]
 Ribosomal RNA
  Large subunit rRNA
   Dmel_CR33391 (5SrRNA:CR33391)
SSDB
Other DBs
NCBI-GeneID: 3772578
FlyBase: FBgn0053391
LinkDB
Position
2R
NT seq 134 nt   +upstreamnt  +downstreamnt
gccaacgaccataccagctgaatacatcggttctcgtccgatcaccgaaatttagcagcg
tcgggcgcggttagtacttagatgggggaccgcttgggaacaccgcgtgttgttggcctc
gtccacaacttttt

DBGET integrated database retrieval system