KEGG   Drosophila melanogaster (fruit fly): Dmel_CR33398
Entry
Dmel_CR33398      rRNA      T00030                                 

Gene name
5SrRNA:CR33398
Definition
(RefSeq) 5S ribosomal RNA
  KO
K01981  large subunit ribosomal RNA, 5S
Organism
dme  Drosophila melanogaster (fruit fly)
Pathway
dme03008  Ribosome biogenesis in eukaryotes
dme03010  Ribosome
Brite
KEGG Orthology (KO) [BR:dme00001]
 09120 Genetic Information Processing
  09122 Translation
   03010 Ribosome
    Dmel_CR33398 (5SrRNA:CR33398)
   03008 Ribosome biogenesis in eukaryotes
    Dmel_CR33398 (5SrRNA:CR33398)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03011 Ribosome [BR:dme03011]
    Dmel_CR33398 (5SrRNA:CR33398)
  09184 RNA family
   03100 Non-coding RNAs [BR:dme03100]
    Dmel_CR33398 (5SrRNA:CR33398)
Ribosome [BR:dme03011]
 Ribosomal RNAs
  Eukaryotes
   Dmel_CR33398 (5SrRNA:CR33398)
Non-coding RNAs [BR:dme03100]
 Ribosomal RNA
  Large subunit rRNA
   Dmel_CR33398 (5SrRNA:CR33398)
SSDB
Other DBs
NCBI-GeneID: 3771820
FlyBase: FBgn0053398
LinkDB
Position
2R
NT seq 135 nt   +upstreamnt  +downstreamnt
gccaacgaccataccacgctgaatacatcggttctcgtccgatcaccgaaattaagcagc
gtcgggcgcggttagtacttagatgagggaccgcttgggaacaccgcgtgttattggcct
cgtccacaacttttt

DBGET integrated database retrieval system