KEGG   Drosophila melanogaster (fruit fly): Dmel_CR44382
Entry
Dmel_CR44382      ncRNA     T00030                                 

Gene name
asRNA:CR44382
Definition
(RefSeq) antisense RNA:CR44382
Organism
dme  Drosophila melanogaster (fruit fly)
SSDB
Other DBs
NCBI-GeneID: 19835487
FlyBase: FBgn0265532
LinkDB
Position
X
NT seq 480 nt   +upstreamnt  +downstreamnt
cctgagtcatcagccgcagatggatgtgctgaactcccccaaacgtgtccgagatgctgt
tttttgcagcacacacaacacacgtcgttgtttatttgcgaattgcttttagtcgccaat
catcactcaccactctccacaacaacactaaacaaaacaaaaacaaaacaactggaatat
cgcgtggaagggaggatgagagcctgggagcgtgcaacaggtcgggggtccgcgtctgtg
ccgagataagcgaagtggagtcgagtggaccaggaacgctgcgagagagccgggagagca
agagccaatgcaatgcgaggcacgtctggcgcgcgtgaactgcggaccgcgtatggcgcg
caacttcgtcgctggattcgactggaactggaagcttcgtgcctccccaacacacacgca
cttctgggctctgtgtgtgtccgtggacacaggaacggtcaagatactaggagccagccc

DBGET integrated database retrieval system