KEGG   Drosophila melanogaster (fruit fly): Dmel_CR44416
Entry
Dmel_CR44416      ncRNA     T00030                                 

Gene name
asRNA:CR44416
Definition
(RefSeq) antisense RNA:CR44416
Organism
dme  Drosophila melanogaster (fruit fly)
SSDB
Other DBs
NCBI-GeneID: 19834735
FlyBase: FBgn0265589
LinkDB
Position
2R
NT seq 281 nt   +upstreamnt  +downstreamnt
gcacctagctttaacattttcctatattgtggttgcgctttcacacgccgcttatattct
ataggaaaataaaattaaatcgctcaaaaatcaccgcctgtccctcgatattttatacac
gtcagcggccgagacaactatcgatatgtttctggatcaacaaacatcgatgcgtaaacg
aagaaccatcgatgcccgctgcaagagtgaccgtatgcatgctctactgtaaactcaacc
gttataaaacattacgtttagattgaatttaaataaaatgt

DBGET integrated database retrieval system