Desulfomicrobium orale: AXF15_10100 Help Entry AXF15_10100       CDS       T04289                                  Name (GenBank) hypothetical protein   KO K03602   exodeoxyribonuclease VII small subunit [EC:3.1.11.6] Organism doa  Desulfomicrobium orale Pathway doa03430   Mismatch repair Brite KEGG Orthology (KO) [BR:doa00001]  09120 Genetic Information Processing   09124 Replication and repair    03430 Mismatch repair     AXF15_10100  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03400 DNA repair and recombination proteins [BR:doa03400]     AXF15_10100 Enzymes [BR:doa01000]  3. Hydrolases   3.1  Acting on ester bonds    3.1.11  Exodeoxyribonucleases producing 5'-phosphomonoesters     3.1.11.6  exodeoxyribonuclease VII      AXF15_10100 DNA repair and recombination proteins [BR:doa03400]  Prokaryotic type   SSBR (single strand breaks repair)    MMR (mismatch excision repair)     DNA exonucleases      AXF15_10100 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Exonuc_VII_S Motif Other DBs NCBI-ProteinID:  AMD93413 UniProt:  A0A0X8JR86 LinkDB All DBs Position complement(2162996..2163202) Genome browser AA seq 68 aa AA seqDB search MANSPQTFEKRLERVREIVALLEAGDVPLEEGVRLFQEGVRLSGECALELKQARIIVENA GNTPEENA NT seq 207 nt NT seq  +upstreamnt  +downstreamnt atggccaattcgccgcagacttttgaaaaacgtctggaacgggtcagggaaatcgtggcc ttgctggaggcaggggacgtgcctctggaagagggcgtcaggctttttcaggaaggcgtg cgtctgtccggagaatgcgctctggaactgaagcaggccagaatcattgtcgaaaacgcc ggaaacacgccggaggaaaatgcatga

DBGET integrated database retrieval system