KEGG   Escherichia coli O7 K1 IAI39 (ExPEC): ECIAI39_miscRNA43Help
Entry
ECIAI39_miscRNA43 misc_RNA  T00829                                 

Gene name
micC
Definition
(RefSeq) MicC
  KO
K18512  small regulatory RNA MicC
Organism
ect  Escherichia coli O7:K1 IAI39 (ExPEC)
Brite
KEGG Orthology (KO) [BR:ect00001]
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03019 Messenger RNA biogenesis [BR:ect03019]
    ECIAI39_miscRNA43 (micC)
  09184 RNA family
   03100 Non-coding RNAs [BR:ect03100]
    ECIAI39_miscRNA43 (micC)
Messenger RNA biogenesis [BR:ect03019]
 Prokaryotic type
  Bacterial mRNA degradation factors
   Other RNA degradation factors
    Bacterial Small RNA Regulators
     ECIAI39_miscRNA43 (micC)
Non-coding RNAs [BR:ect03100]
 Other RNA
  Unclassified
   ECIAI39_miscRNA43 (micC)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 7152295
LinkDB All DBs
Position
1771949..1772052
Genome map
NT seq 104 nt NT seq  +upstreamnt  +downstreamnt
gttatatgcctttattgtcacaaagattattttctgttggacccttgttactatttatcc
aacaaataatgagacaagcccgaacagtcgtccgggcttttttt

DBGET integrated database retrieval system