KEGG   Homo sapiens (human): 100302238Help
Entry
100302238         miRNA     T01001                                 

Gene name
MIR103B1, MIR103-1AS, MIRN103-1AS, hsa-mir-103-1-as
Definition
(RefSeq) microRNA 103b-1
  KO
K16989  microRNA 103
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    100302238 (MIR103B1)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    100302238 (MIR103B1)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    100302238 (MIR103B1)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of haemopoietic cells
   100302238 (MIR103B1)
  Exosomal RNA of ovarian cancer cells
   100302238 (MIR103B1)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   100302238 (MIR103B1)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 100302238
HGNC: 35384
Ensembl: ENSG00000283612
miRBase: MI0007261
LinkDB All DBs
Position
5q34
NT seq 23 nt NT seq  +upstreamnt  +downstreamnt
tcatagccctgtacaatgctgct

DBGET integrated database retrieval system