KEGG   Homo sapiens (human): 100616173Help
Entry
100616173         miRNA     T01001                                 

Gene name
MIR203B, MIR3545, hsa-mir-203b
Definition
(RefSeq) microRNA 203b
  KO
K16975  microRNA 203
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    100616173 (MIR203B)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    100616173 (MIR203B)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    100616173 (MIR203B)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of ovarian cancer cells
   100616173 (MIR203B)
  Exosomal RNA of lung cancer cells
   100616173 (MIR203B)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   100616173 (MIR203B)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 100616173
HGNC: 41811
Ensembl: ENSG00000283165
miRBase: MI0017343
LinkDB All DBs
Position
14q32.33
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
tagtggtcctaaacatttcaca

DBGET integrated database retrieval system