KEGG   Homo sapiens (human): 27113
Entry
27113             CDS       T01001                                 

Gene name
BBC3, JFY-1, JFY1, PUMA
Definition
(RefSeq) BCL2 binding component 3
  KO
K10132  Bcl-2-binding component 3
Organism
hsa  Homo sapiens (human)
Pathway
hsa01524  Platinum drug resistance
hsa04115  p53 signaling pathway
hsa04210  Apoptosis
hsa04215  Apoptosis - multiple species
hsa04390  Hippo signaling pathway
hsa05016  Huntington disease
hsa05162  Measles
hsa05200  Pathways in cancer
hsa05210  Colorectal cancer
Network
nt06131  Apoptosis (viruses and bacteria)
nt06161  Human immunodeficiency virus type 1 (HIV-1)
nt06165  Epstein-Barr virus (EBV)
nt06166  Human papillomavirus (HPV)
nt06168  Herpes simplex virus 1 (HSV-1)
nt06169  Measles virus (MV)
nt06170  Influenza A virus (IAV)
nt06231  Apoptosis
nt06260  Colorectal cancer
nt06267  Small cell lung cancer
nt06414  Apoptosis
nt06440  Transcription
nt06461  Huntington disease
nt06463  Parkinson disease
nt06464  Amyotrophic lateral sclerosis
  Element
N00098  Intrinsic apoptotic pathway
N00695  MV V to p73-mediated transcription
N00982  Mutation-caused aberrant Htt to p53-mediated transcription
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09130 Environmental Information Processing
  09132 Signal transduction
   04390 Hippo signaling pathway
    27113 (BBC3)
 09140 Cellular Processes
  09143 Cell growth and death
   04210 Apoptosis
    27113 (BBC3)
   04215 Apoptosis - multiple species
    27113 (BBC3)
   04115 p53 signaling pathway
    27113 (BBC3)
 09160 Human Diseases
  09161 Cancer: overview
   05200 Pathways in cancer
    27113 (BBC3)
  09162 Cancer: specific types
   05210 Colorectal cancer
    27113 (BBC3)
  09164 Neurodegenerative disease
   05016 Huntington disease
    27113 (BBC3)
  09172 Infectious disease: viral
   05162 Measles
    27113 (BBC3)
  09176 Drug resistance: antineoplastic
   01524 Platinum drug resistance
    27113 (BBC3)
SSDB
Other DBs
NCBI-GeneID: 27113
NCBI-ProteinID: NP_001120712
OMIM: 605854
HGNC: 17868
Ensembl: ENSG00000105327
Vega: OTTHUMG00000183489
Pharos: Q9BXH1(Tbio)
UniProt: Q96PG8 Q9BXH1
LinkDB
Position
19q13.32
AA seq 261 aa
MKFGMGSAQACPCQVPRAASTTWVPCQICGPRERHGPRTPGGQLPGARRGPGPRRPAPLP
ARPPGALGSVLRPLRARPGCRPRRPHPAARCLPLRPHRPTRRHRRPGGFPLAWGSPQPAP
RPAPGRSSALALAGGAAPGVARAQRPGGSGGRSHPGGPGSPRGGGTVGPGDRGPAAADGG
RPQRTVRAAETRGAAAAPPLTLEGPVQSHHGTPALTQGPQSPRDGAQLGACTRPVDVRDS
GGRPLPPPDTLASAGDFLCTM
NT seq 786 nt   +upstreamnt  +downstreamnt
atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccagggctgcttcc
acgacgtgggtcccctgccagatttgtggccccagggagcgccatggcccgcgcacgcca
ggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttccc
gctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgc
cgcccccgccgcccccaccctgctgcccgctgcctacctctgcgcccccaccgccccacc
cgccgtcaccgccgccctggggggttcccgctggcctgggggtccccgcagccggccccg
aggcccgcgcccggacggtcctcagccctcgctctcgctggcggagcagcacctggagtc
gcccgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccccgggagt
ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatggcgga
cgacctcaacgcacagtacgagcggcggagacaagaggagcagcagcggcaccgcccctc
accctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacag
agcccccgagatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcg
gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcacc
atgtag

DBGET integrated database retrieval system