KEGG   Homo sapiens (human): 406886Help
Entry
406886            miRNA     T01001                                 

Gene name
MIRLET7D, LET7D, MIRNLET7D, hsa-let-7d, let-7d
Definition
(RefSeq) microRNA let-7d
  KO
K16980  microRNA let-7
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406886 (MIRLET7D)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406886 (MIRLET7D)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406886 (MIRLET7D)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of breast milk
   406886 (MIRLET7D)
  Exosomal RNA of saliva
   406886 (MIRLET7D)
  Exosomal RNA of ovarian cancer cells
   406886 (MIRLET7D)
  Exosomal RNA of renal carcinoma cells
   406886 (MIRLET7D)
  Exosomal RNA of other cancer cells
   406886 (MIRLET7D)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   406886 (MIRLET7D)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 406886
OMIM: 612145
HGNC: 31481
Ensembl: ENSG00000199133
miRBase: MI0000065
LinkDB All DBs
Position
9q22.32
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
agaggtagtaggttgcatagtt

DBGET integrated database retrieval system