KEGG   Homo sapiens (human): 406892Help
Entry
406892            miRNA     T01001                                 

Gene name
MIR100, MIRN100, miR-100
Definition
(RefSeq) microRNA 100
  KO
K17041  microRNA 100
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406892 (MIR100)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406892 (MIR100)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   406892 (MIR100)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 406892
OMIM: 613186
HGNC: 31487
Ensembl: ENSG00000207994
miRBase: MI0000102
LinkDB All DBs
Position
11q24.1
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
aacccgtagatccgaacttgtg

DBGET integrated database retrieval system