KEGG   Homo sapiens (human): 406903Help
Entry
406903            miRNA     T01001                                 

Gene name
MIR10B, MIRN10B, hsa-mir-10b, miRNA10B, mir-10b
Definition
(RefSeq) microRNA 10b
  KO
K17393  microRNA 10b
Organism
hsa  Homo sapiens (human)
Pathway
hsa05205  Proteoglycans in cancer
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406903 (MIR10B)
   05205 Proteoglycans in cancer
    406903 (MIR10B)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406903 (MIR10B)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   406903 (MIR10B)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 406903
OMIM: 611576
HGNC: 31498
Ensembl: ENSG00000207744
miRBase: MI0000267
LinkDB All DBs
Position
2q31.1
NT seq 23 nt NT seq  +upstreamnt  +downstreamnt
taccctgtagaaccgaatttgtg

DBGET integrated database retrieval system