KEGG   Homo sapiens (human): 406904Help
Entry
406904            miRNA     T01001                                 

Gene name
MIR1-1, MIRN1-1, hsa-mir-1-1, miRNA1-1, mir-1-1
Definition
(RefSeq) microRNA 1-1
  KO
K16972  microRNA 1
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406904 (MIR1-1)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406904 (MIR1-1)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406904 (MIR1-1)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of muscle cells
   406904 (MIR1-1)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   406904 (MIR1-1)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 406904
OMIM: 609326
HGNC: 31499
Ensembl: ENSG00000199017
miRBase: MI0000651
LinkDB All DBs
Position
20q13.33
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
acatacttctttatatgcccat

DBGET integrated database retrieval system