KEGG   Homo sapiens (human): 406907Help
Entry
406907            miRNA     T01001                                 

Gene name
MIR124-1, MIR124A, MIR124A1, MIRN124-1, MIRN124A1, mir-124-1
Definition
(RefSeq) microRNA 124-1
  KO
K17126  microRNA 124
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406907 (MIR124-1)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406907 (MIR124-1)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406907 (MIR124-1)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of neural cells
   406907 (MIR124-1)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   406907 (MIR124-1)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 406907
OMIM: 609327
HGNC: 31502
Ensembl: ENSG00000284321
miRBase: MI0000443
LinkDB All DBs
Position
8p23.1
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
cgtgttcacagcggaccttgat

DBGET integrated database retrieval system