KEGG   Homo sapiens (human): 406915Help
Entry
406915            miRNA     T01001                                 

Gene name
MIR128-1, MIR128A, MIRN128-1, MIRN128A, mir-128-1
Definition
(RefSeq) microRNA 128-1
  KO
K17130  microRNA 128
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406915 (MIR128-1)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406915 (MIR128-1)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406915 (MIR128-1)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of breast milk
   406915 (MIR128-1)
  Exosomal RNA of saliva
   406915 (MIR128-1)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   406915 (MIR128-1)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 406915
OMIM: 611774
HGNC: 31510
Ensembl: ENSG00000207654
miRBase: MI0000447
LinkDB All DBs
Position
2q21.3
NT seq 23 nt NT seq  +upstreamnt  +downstreamnt
cggggccgtagcactgtctgaga

DBGET integrated database retrieval system