KEGG   Homo sapiens (human): 406925Help
Entry
406925            miRNA     T01001                                 

Gene name
MIR135A1, MIRN135-1, MIRN135A1, mir-135a-1
Definition
(RefSeq) microRNA 135a-1
  KO
K17144  microRNA 135
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406925 (MIR135A1)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406925 (MIR135A1)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406925 (MIR135A1)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of ovarian cancer cells
   406925 (MIR135A1)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   406925 (MIR135A1)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 406925
HGNC: 31520
Ensembl: ENSG00000207926
miRBase: MI0000452
LinkDB All DBs
Position
3p21.2
NT seq 23 nt NT seq  +upstreamnt  +downstreamnt
tatggctttttattcctatgtga

DBGET integrated database retrieval system