KEGG   Homo sapiens (human): 406935Help
Entry
406935            miRNA     T01001                                 

Gene name
MIR143, MIRN143, mir-143
Definition
(RefSeq) microRNA 143
  KO
K17023  microRNA 143
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406935 (MIR143)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406935 (MIR143)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   406935 (MIR143)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 406935
OMIM: 612117
HGNC: 31530
Ensembl: ENSG00000284182
miRBase: MI0000459
LinkDB All DBs
Position
5q32
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
ggtgcagtgctgcatctctggt

DBGET integrated database retrieval system