KEGG   Homo sapiens (human): 406937Help
Entry
406937            miRNA     T01001                                 

Gene name
MIR145, MIRN145, miR-145, miRNA145
Definition
(RefSeq) microRNA 145
  KO
K16974  microRNA 145
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406937 (MIR145)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406937 (MIR145)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406937 (MIR145)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of hepatic cancer cells
   406937 (MIR145)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   406937 (MIR145)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 406937
OMIM: 611795
HGNC: 31532
Ensembl: ENSG00000276365
miRBase: MI0000461
LinkDB All DBs
Position
5q32
NT seq 23 nt NT seq  +upstreamnt  +downstreamnt
gtccagttttcccaggaatccct

DBGET integrated database retrieval system