KEGG   Homo sapiens (human): 406938Help
Entry
406938            miRNA     T01001                                 

Gene name
MIR146A, MIRN146, MIRN146A, miR-146a, miRNA146A
Definition
(RefSeq) microRNA 146a
  KO
K17012  microRNA 146a
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406938 (MIR146A)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406938 (MIR146A)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406938 (MIR146A)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of breast milk
   406938 (MIR146A)
  Exosomal RNA of renal carcinoma cells
   406938 (MIR146A)
  Exosomal RNA of lung cancer cells
   406938 (MIR146A)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   406938 (MIR146A)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 406938
OMIM: 610566
HGNC: 31533
Ensembl: ENSG00000283733
miRBase: MI0000477
LinkDB All DBs
Position
5q33.3
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
tgagaactgaattccatgggtt

DBGET integrated database retrieval system