KEGG   Homo sapiens (human): 406942Help
Entry
406942            miRNA     T01001                                 

Gene name
MIR150, MIRN150, miRNA150, mir-150
Definition
(RefSeq) microRNA 150
  KO
K17024  microRNA 150
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406942 (MIR150)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406942 (MIR150)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406942 (MIR150)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of saliva
   406942 (MIR150)
  Exosomal RNA of ovarian cancer cells
   406942 (MIR150)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   406942 (MIR150)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 406942
OMIM: 611114
HGNC: 31537
Ensembl: ENSG00000207782
miRBase: MI0000479
LinkDB All DBs
Position
19q13.33
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
tctcccaacccttgtaccagtg

DBGET integrated database retrieval system