KEGG   Homo sapiens (human): 406943
Entry
406943            miRNA     T01001                                 

Gene name
MIR152, MIRN152, mir-152
Definition
(RefSeq) microRNA 152
  KO
K17370  microRNA 152
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406943 (MIR152)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406943 (MIR152)
Non-coding RNAs [BR:hsa03100]
 Small non-coding RNA
  Micro RNA
   406943 (MIR152)
SSDB
Other DBs
NCBI-GeneID: 406943
OMIM: 613788
HGNC: 31538
Ensembl: ENSG00000207947
miRBase: MI0000462
LinkDB
Position
17q21.32
NT seq 23 nt   +upstreamnt  +downstreamnt
aggttctgtgatacactccgact

DBGET integrated database retrieval system