KEGG   Homo sapiens (human): 406947Help
Entry
406947            miRNA     T01001                                 

Gene name
MIR155, MIRN155, miRNA155, mir-155
Definition
(RefSeq) microRNA 155
  KO
K17009  microRNA 155
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Drug target
Cobomarsen: D11163
Cobomarsen sodium: D11164
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406947 (MIR155)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406947 (MIR155)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406947 (MIR155)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of breast milk
   406947 (MIR155)
  Exosomal RNA of lung cancer cells
   406947 (MIR155)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   406947 (MIR155)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 406947
OMIM: 609337
HGNC: 31542
Ensembl: ENSG00000283904
miRBase: MI0000681
LinkDB All DBs
Position
21q21.3
NT seq 24 nt NT seq  +upstreamnt  +downstreamnt
ttaatgctaatcgtgataggggtt

DBGET integrated database retrieval system