Homo sapiens (human): 406951 Help Entry 406951            miRNA     T01001                                  Symbol MIR16-2, MIRN16-2, mir-16-2, mir-16-3 Name (RefSeq) microRNA 16-2   KO K16988   microRNA 16 Organism hsa  Homo sapiens (human) Pathway hsa05206   MicroRNAs in cancer Brite KEGG Orthology (KO) [BR:hsa00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     406951 (MIR16-2)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:hsa04147]     406951 (MIR16-2)   09184 RNA family    03100 Non-coding RNAs [BR:hsa03100]     406951 (MIR16-2) Exosome [BR:hsa04147]  Exosomal RNA   Exosomal RNA of breast milk    406951 (MIR16-2)   Exosomal RNA of hepatic cancer cells    406951 (MIR16-2)   Exosomal RNA of lung cancer cells    406951 (MIR16-2)   Exosomal RNA of other cancer cells    406951 (MIR16-2) Non-coding RNAs [BR:hsa03100]  Small non-coding RNA   Micro RNA    406951 (MIR16-2) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  406951 HGNC:  31546 Ensembl:  ENSG00000198987 miRBase:  MI0000115 LinkDB All DBs Position 3:160404745..160404825 Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt tagcagcacgtaaatattggcg

DBGET integrated database retrieval system