KEGG   Homo sapiens (human): 406951Help
Entry
406951            miRNA     T01001                                 

Gene name
MIR16-2, MIRN16-2, mir-16-2, mir-16-3
Definition
(RefSeq) microRNA 16-2
  KO
K16988  microRNA 16
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406951 (MIR16-2)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406951 (MIR16-2)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406951 (MIR16-2)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of breast milk
   406951 (MIR16-2)
  Exosomal RNA of hepatic cancer cells
   406951 (MIR16-2)
  Exosomal RNA of lung cancer cells
   406951 (MIR16-2)
  Exosomal RNA of other cancer cells
   406951 (MIR16-2)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   406951 (MIR16-2)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 406951
HGNC: 31546
Ensembl: ENSG00000198987
miRBase: MI0000115
LinkDB All DBs
Position
3q25.33
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
tagcagcacgtaaatattggcg

DBGET integrated database retrieval system