KEGG   Homo sapiens (human): 406954Help
Entry
406954            miRNA     T01001                                 

Gene name
MIR181A2, MIRN181A, MIRN181A2, hsa-mir-181a-2, mir-181a-2
Definition
(RefSeq) microRNA 181a-2
  KO
K17025  microRNA 181a
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406954 (MIR181A2)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406954 (MIR181A2)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406954 (MIR181A2)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of breast milk
   406954 (MIR181A2)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   406954 (MIR181A2)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 406954
OMIM: 612743
HGNC: 31549
Ensembl: ENSG00000207595
miRBase: MI0000269
LinkDB All DBs
Position
9q33.3
NT seq 23 nt NT seq  +upstreamnt  +downstreamnt
aacattcaacgctgtcggtgagt

DBGET integrated database retrieval system