KEGG   Homo sapiens (human): 406959Help
Entry
406959            miRNA     T01001                                 

Gene name
MIR183, MIRN183, miR-183, miRNA183
Definition
(RefSeq) microRNA 183
  KO
K17116  microRNA 183
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406959 (MIR183)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406959 (MIR183)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406959 (MIR183)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of haemopoietic cells
   406959 (MIR183)
  Exosomal RNA of renal carcinoma cells
   406959 (MIR183)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   406959 (MIR183)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 406959
OMIM: 611608
HGNC: 31554
Ensembl: ENSG00000207691
miRBase: MI0000273
LinkDB All DBs
Position
7q32.2
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
tatggcactggtagaattcact

DBGET integrated database retrieval system