KEGG   Homo sapiens (human): 406978Help
Entry
406978            miRNA     T01001                                 

Gene name
MIR199B, MIRN199B, mir-199b
Definition
(RefSeq) microRNA 199b
  KO
K17119  microRNA 199b
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406978 (MIR199B)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406978 (MIR199B)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406978 (MIR199B)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of hepatic cancer cells
   406978 (MIR199B)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   406978 (MIR199B)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 406978
OMIM: 614791
HGNC: 31573
Ensembl: ENSG00000207581
miRBase: MI0000282
LinkDB All DBs
Position
9q34.11
NT seq 23 nt NT seq  +upstreamnt  +downstreamnt
cccagtgtttagactatctgttc

DBGET integrated database retrieval system