KEGG   Homo sapiens (human): 406979Help
Entry
406979            miRNA     T01001                                 

Gene name
MIR19A, C13orf25, MIR17HG, MIRH1, MIRHG1, MIRN19A, hsa-mir-19a, miR-19a, miRNA19A
Definition
(RefSeq) microRNA 19a
  KO
K17005  microRNA 19a
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406979 (MIR19A)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406979 (MIR19A)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406979 (MIR19A)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of renal carcinoma cells
   406979 (MIR19A)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   406979 (MIR19A)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 406979
OMIM: 609418
HGNC: 31574
Ensembl: ENSG00000284204
miRBase: MI0000073
LinkDB All DBs
Position
13q31.3
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
agttttgcatagttgcactaca

DBGET integrated database retrieval system