KEGG   Homo sapiens (human): 406980Help
Entry
406980            miRNA     T01001                                 

Gene name
MIR19B1, C13orf25, MIR17HG, MIR19B, MIRH1, MIRHG1, MIRN19B1, miR-19b-1, miRNA19B1
Definition
(RefSeq) microRNA 19b-1
  KO
K23559  microRNA 19b
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406980 (MIR19B1)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406980 (MIR19B1)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406980 (MIR19B1)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of renal carcinoma cells
   406980 (MIR19B1)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   406980 (MIR19B1)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 406980
OMIM: 609419
HGNC: 31575
Ensembl: ENSG00000284375
miRBase: MI0000074
LinkDB All DBs
Position
13q31.3
NT seq 23 nt NT seq  +upstreamnt  +downstreamnt
agttttgcaggtttgcatccagc

DBGET integrated database retrieval system