KEGG   Homo sapiens (human): 406983Help
Entry
406983            miRNA     T01001                                 

Gene name
MIR200A, MIRN200A, mir-200a
Definition
(RefSeq) microRNA 200a
  KO
K17015  microRNA 200a
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406983 (MIR200A)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406983 (MIR200A)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406983 (MIR200A)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of ovarian cancer cells
   406983 (MIR200A)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   406983 (MIR200A)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 406983
OMIM: 612090
HGNC: 31578
Ensembl: ENSG00000207607
miRBase: MI0000737
LinkDB All DBs
Position
1p36.33
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
catcttaccggacagtgctgga

DBGET integrated database retrieval system