KEGG   Homo sapiens (human): 406991Help
Entry
406991            miRNA     T01001                                 

Gene name
MIR21, MIRN21, hsa-mir-21, miR-21, miRNA21
Definition
(RefSeq) microRNA 21
  KO
K16863  microRNA 21
Organism
hsa  Homo sapiens (human)
Pathway
hsa05205  Proteoglycans in cancer
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406991 (MIR21)
   05205 Proteoglycans in cancer
    406991 (MIR21)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406991 (MIR21)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406991 (MIR21)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of breast milk
   406991 (MIR21)
  Exosomal RNA of ovarian cancer cells
   406991 (MIR21)
  Exosomal RNA of lung cancer cells
   406991 (MIR21)
  Exosomal RNA of other cancer cells
   406991 (MIR21)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   406991 (MIR21)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 406991
OMIM: 611020
HGNC: 31586
Ensembl: ENSG00000284190
miRBase: MI0000077
LinkDB All DBs
Position
17q23.1
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
tagcttatcagactgatgttga

DBGET integrated database retrieval system