KEGG   Homo sapiens (human): 407006Help
Entry
407006            miRNA     T01001                                 

Gene name
MIR221, MIRN221, miRNA221, mir-221
Definition
(RefSeq) microRNA 221
  KO
K17010  microRNA 221
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    407006 (MIR221)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    407006 (MIR221)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   407006 (MIR221)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 407006
OMIM: 300568
HGNC: 31601
Ensembl: ENSG00000207870
miRBase: MI0000298
LinkDB All DBs
Position
Xp11.3
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
acctggcatacaatgtagattt

DBGET integrated database retrieval system