KEGG   Homo sapiens (human): 407008Help
Entry
407008            miRNA     T01001                                 

Gene name
MIR223, MIRN223, miRNA223, mir-223
Definition
(RefSeq) microRNA 223
  KO
K17001  microRNA 223
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    407008 (MIR223)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    407008 (MIR223)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    407008 (MIR223)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of breast milk
   407008 (MIR223)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   407008 (MIR223)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 407008
OMIM: 300694
HGNC: 31603
Ensembl: ENSG00000284567
miRBase: MI0000300
LinkDB All DBs
Position
Xq12
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
cgtgtatttgacaagctgagtt

DBGET integrated database retrieval system