KEGG   Homo sapiens (human): 407009Help
Entry
407009            miRNA     T01001                                 

Gene name
MIR224, MIRN224, miRNA224
Definition
(RefSeq) microRNA 224
  KO
K17042  microRNA 224
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    407009 (MIR224)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    407009 (MIR224)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   407009 (MIR224)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 407009
OMIM: 300769
HGNC: 31604
Ensembl: ENSG00000284363
miRBase: MI0000301
LinkDB All DBs
Position
Xq28
NT seq 25 nt NT seq  +upstreamnt  +downstreamnt
tcaagtcactagtggttccgtttag

DBGET integrated database retrieval system