KEGG   Homo sapiens (human): 407015Help
Entry
407015            miRNA     T01001                                 

Gene name
MIR26A1, MIR26A, MIRN26A1, mir-26a-1
Definition
(RefSeq) microRNA 26a-1
  KO
K16984  microRNA 26a
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    407015 (MIR26A1)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    407015 (MIR26A1)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    407015 (MIR26A1)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of other cancer cells
   407015 (MIR26A1)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   407015 (MIR26A1)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 407015
OMIM: 612151
HGNC: 31610
Ensembl: ENSG00000199075
miRBase: MI0000083
LinkDB All DBs
Position
3p22.2
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
ttcaagtaatccaggataggct

DBGET integrated database retrieval system