KEGG   Homo sapiens (human): 407016Help
Entry
407016            miRNA     T01001                                 

Gene name
MIR26A2, MIRN26A2, mir-26a-2
Definition
(RefSeq) microRNA 26a-2
  KO
K16984  microRNA 26a
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    407016 (MIR26A2)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    407016 (MIR26A2)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    407016 (MIR26A2)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of other cancer cells
   407016 (MIR26A2)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   407016 (MIR26A2)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 407016
OMIM: 613057
HGNC: 31611
Ensembl: ENSG00000207789
miRBase: MI0000750
LinkDB All DBs
Position
12q14.1
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
ttcaagtaatccaggataggct

DBGET integrated database retrieval system