KEGG   Homo sapiens (human): 407018Help
Entry
407018            miRNA     T01001                                 

Gene name
MIR27A, MIR27, MIRN27A, mir-27a
Definition
(RefSeq) microRNA 27a
  KO
K17112  microRNA 27a
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    407018 (MIR27A)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    407018 (MIR27A)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    407018 (MIR27A)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of other cancer cells
   407018 (MIR27A)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   407018 (MIR27A)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 407018
OMIM: 612153
HGNC: 31613
Ensembl: ENSG00000207808
miRBase: MI0000085
LinkDB All DBs
Position
19p13.12
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
agggcttagctgcttgtgagca

DBGET integrated database retrieval system