KEGG   Homo sapiens (human): 407019Help
Entry
407019            miRNA     T01001                                 

Gene name
MIR27B, MIR-27b, MIRN27B, miRNA27B
Definition
(RefSeq) microRNA 27b
  KO
K17113  microRNA 27b
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    407019 (MIR27B)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    407019 (MIR27B)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    407019 (MIR27B)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of haemopoietic cells
   407019 (MIR27B)
  Exosomal RNA of saliva
   407019 (MIR27B)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   407019 (MIR27B)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 407019
OMIM: 610636
HGNC: 31614
Ensembl: ENSG00000207864
miRBase: MI0000440
LinkDB All DBs
Position
9q22.32
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
agagcttagctgattggtgaac

DBGET integrated database retrieval system