KEGG   Homo sapiens (human): 407021Help
Entry
407021            miRNA     T01001                                 

Gene name
MIR29A, MIRN29, MIRN29A, hsa-mir-29, hsa-mir-29a, miRNA29A, mir-29a
Definition
(RefSeq) microRNA 29a
  KO
K16995  microRNA 29a
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    407021 (MIR29A)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    407021 (MIR29A)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    407021 (MIR29A)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of hepatic cancer cells
   407021 (MIR29A)
  Exosomal RNA of renal carcinoma cells
   407021 (MIR29A)
  Exosomal RNA of lung cancer cells
   407021 (MIR29A)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   407021 (MIR29A)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 407021
OMIM: 610782
HGNC: 31616
Ensembl: ENSG00000284032
miRBase: MI0000087
LinkDB All DBs
Position
7q32.3
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
actgatttcttttggtgttcag

DBGET integrated database retrieval system