KEGG   Homo sapiens (human): 407026Help
Entry
407026            miRNA     T01001                                 

Gene name
MIR29C, MIRN29C, miRNA29C, mir-29c
Definition
(RefSeq) microRNA 29c
  KO
K16997  microRNA 29c
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    407026 (MIR29C)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    407026 (MIR29C)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    407026 (MIR29C)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of saliva
   407026 (MIR29C)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   407026 (MIR29C)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 407026
OMIM: 610784
HGNC: 31621
Ensembl: ENSG00000284214
miRBase: MI0000735
LinkDB All DBs
Position
1q32.2
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
tgaccgatttctcctggtgttc

DBGET integrated database retrieval system