KEGG   Homo sapiens (human): 407029Help
Entry
407029            miRNA     T01001                                 

Gene name
MIR30A, MIRN30A, mir-30a
Definition
(RefSeq) microRNA 30a
  KO
K17110  microRNA 30a/d/e
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    407029 (MIR30A)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    407029 (MIR30A)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    407029 (MIR30A)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of hepatic cancer cells
   407029 (MIR30A)
  Exosomal RNA of lung cancer cells
   407029 (MIR30A)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   407029 (MIR30A)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 407029
OMIM: 612329
HGNC: 31624
Ensembl: ENSG00000207827
miRBase: MI0000088
LinkDB All DBs
Position
6q13
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
tgtaaacatcctcgactggaag

DBGET integrated database retrieval system