KEGG   Homo sapiens (human): 407035Help
Entry
407035            miRNA     T01001                                 

Gene name
MIR31, MIRN31, hsa-mir-31, miR-31
Definition
(RefSeq) microRNA 31
  KO
K17183  microRNA 31
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    407035 (MIR31)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    407035 (MIR31)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    407035 (MIR31)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of melanoma cells
   407035 (MIR31)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   407035 (MIR31)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 407035
OMIM: 612155
HGNC: 31630
Ensembl: ENSG00000199177
miRBase: MI0000089
LinkDB All DBs
Position
9p21.3
NT seq 21 nt NT seq  +upstreamnt  +downstreamnt
aggcaagatgctggcatagct

DBGET integrated database retrieval system