KEGG   Homo sapiens (human): 407044Help
Entry
407044            miRNA     T01001                                 

Gene name
MIR7-2, MIRN7-2, hsa-mir-7-2, mir-7-2
Definition
(RefSeq) microRNA 7-2
  KO
K17365  microRNA 7
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    407044 (MIR7-2)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    407044 (MIR7-2)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   407044 (MIR7-2)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 407044
HGNC: 31639
Ensembl: ENSG00000207703
miRBase: MI0000264
LinkDB All DBs
Position
15q26.1
NT seq 24 nt NT seq  +upstreamnt  +downstreamnt
tggaagactagtgattttgttgtt

DBGET integrated database retrieval system